This is a working overview of GW501516, written for readers who want more than a one-paragraph summary but less than a textbook.
This page was last updated on 2026-08-01 and is reviewed periodically as new material appears.
Detection of GW501516 in biological samples generally relies on liquid chromatography coupled with tandem mass spectrometry. Urine is a common matrix in anti-doping analysis, while blood or plasma may be used in research settings. Sample preparation can involve enzymatic hydrolysis, protein precipitation, or solid-phase extraction before instrumental analysis. Because the compound undergoes metabolism, assays may target the parent molecule, one or more metabolites, or both. Detection windows are not fixed; they depend on factors such as dose, route, individual metabolism, and assay sensitivity. Reference standards are required for accurate identification and quantification.
Handling and quality assessment of cardarine reference material follow general laboratory practices for poorly characterized compounds. It typically appears as a white to off-white powder and is sparingly soluble in water but soluble in organic solvents such as dimethyl sulfoxide and ethanol. Storage recommendations usually specify a cool, dry, dark place, with long-term storage at low temperature and desiccation. Purity may be checked by high-performance liquid chromatography with ultraviolet detection, while identity is confirmed by mass spectrometry and nuclear magnetic resonance. No pharmacopeial monograph exists, so reported purity and stability depend on the supplier’s methods.
GW501516 acts as a selective agonist at PPARδ, a nuclear receptor that regulates transcription of genes involved in lipid handling and energy metabolism. Activation of PPARδ in preclinical models increases fatty acid oxidation, mitochondrial biogenesis, and exercise endurance in rodents. These effects have made the compound a subject of metabolic research and also a target for sport anti-doping rules. In humans, however, controlled studies are limited, and whether similar endurance or metabolic changes occur at tolerated exposures remains an open question. The receptor’s broad tissue distribution also means downstream effects may vary by organ and condition.
Human trials of GW501516 were small and short in duration. They examined lipid levels, glucose handling, and other metabolic markers, but the programs were halted after the animal cancer findings. No approved therapeutic product exists, and published human data are insufficient for establishing long-term safety. Reports of use for athletic performance come mainly from non-clinical settings and cannot be verified through controlled trials. Independent testing of products sold as cardarine has found inconsistent purity and labeling.
Laboratory studies indicate that GW501516 activates PPARδ, a nuclear receptor involved in fatty acid oxidation and energy metabolism. In rodent experiments, treated animals often showed increased endurance and reduced fat mass. These effects were observed under controlled conditions and do not establish safe or effective use in humans. The exact dose-response relationship in humans remains poorly characterized. Species differences in metabolism can affect how results translate across animals and people.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off-white powder | Visual description for typical solid reference material. |
| Solubility | Poorly soluble in water; soluble in DMSO | Solubility depends on solvent, purity, and form. |
| Storage | Cool, dry, protected from light | Long-term storage often uses low temperature and desiccant. |
| Common analytical method | LC-MS/MS | Used for detection and quantification in biological matrices. |
| Common synonyms | GW-501516; GW501516; endurobol | Naming varies among literature, vendors, and databases. |
The pharmacological interest in cardarine centers on PPARδ activation and its downstream effects on lipid handling and mitochondrial function. In animal studies, PPARδ agonists have been associated with changes in exercise endurance and fatty acid utilization, though results vary by model and protocol. Human data remain sparse, and the absence of large controlled trials limits conclusions about efficacy. Researchers often describe the compound as a tool for probing PPARδ biology rather than a proven therapeutic agent.
Safety discussions about cardarine frequently cite rodent carcinogenicity findings reported in the 2000s. In those studies, treated animals developed tumors at multiple sites, leading sponsors to discontinue clinical development. The relevance of these findings to humans has not been resolved, but they are a major reason the compound is not approved. Current literature emphasizes uncertainty about long-term effects and the risks of unregulated use. Regulators and health agencies have not established a safe human exposure level.
Literature on cardarine often separates receptor pharmacology from toxicology. Mechanistic papers describe PPARδ activation and gene expression changes, while safety assessments focus on carcinogenicity and species differences. Questions remain about whether rodent tumors arise through PPARδ-dependent or off-target mechanisms. Another open area is how human metabolism and exposure compare with those in animal studies. Analytical methods such as liquid chromatography–mass spectrometry are used to confirm identity in biological and product samples.
GW501516 acts as an agonist at the peroxisome proliferator-activated receptor delta, a nuclear receptor that regulates gene expression. Activation shifts transcription toward genes involved in fatty acid uptake, oxidation, and energy expenditure. The compound does not bind the androgen receptor and therefore differs from anabolic steroids and SARMs. In rodent models, this metabolic shift has been linked to increased running endurance and reduced fat accumulation. The exact downstream pathways in humans remain incompletely characterized.
Finally, a recent systematic review of 850 research papers on the topic concluded that "the majority of well-conducted studies found that higher levels of religious involvement are positively associated with indicators of psychological well-being (life satisfaction, happiness, positive affect, and higher morale) and with less depression, suicidal thoughts and behaviour, drug/alcohol use/abuse." However, there remains strong disagreement among scholars about whether the effects of religious observance, particularly attending church or otherwise belonging to religious groups, is due to the spiritual or the social aspects—i.e. those who attend church or belong to similar religious organizations may well be receiving only the effects of the social connections involved. While these benefits are real enough, they may thus be the same one would gain by joining other, secular groups, clubs, or similar organizations. Religiousness has often been found to correlate with positive health attributes. People who are more religious show better emotional well-being and lower rates of delinquency, alcoholism, drug abuse, and other social problems. Six separate factors are cited as evidence for religion's effect on well-being: religion (1) provides social support, (2) supports healthy lifestyles, (3) promotes personality integration, (4) promotes generativity and altruism, (5) provides unique coping strategies, and (6) provides a sense of meaning and purpose.
== Selected publications == Brodbelt, Jennifer S. (24 March 2014). "Photodissociation mass spectrometry: new tools for characterization of biological molecules". Chemical Society Reviews. 43 (8): 2757–2783. doi:10.1039/C3CS60444F. ISSN 1460-4744. PMC 3966968. PMID 24481009. Shaw, Jared B.; Li, Wenzong; Holden, Dustin D.; Zhang, Yan; Griep-Raming, Jens; Fellers, Ryan T.; Early, Bryan P.; Thomas, Paul M.; Kelleher, Neil L.; Brodbelt, Jennifer S. (28 August 2013). "Complete Protein Characterization Using Top-Down Mass Spectrometry and Ultraviolet Photodissociation". Journal of the American Chemical Society. 135 (34): 12646–12651. Bibcode:2013JAChS.13512646S. doi:10.1021/ja4029654. PMC 3757099. PMID 23697802. Kempen, Esther C.; Brodbelt, Jennifer S. (1 November 2000). "A Method for the Determination of Binding Constants by Electrospray Ionization Mass Spectrometry". Analytical Chemistry. 72 (21): 5411–5416. doi:10.1021/ac000540e. ISSN 0003-2700. PMID 11080894.
=== Ivermectin === Oral ivermectin is effective in eradicating scabies, often in a single dose. It is the treatment of choice for crusted scabies, and is sometimes prescribed in combination with a topical agent. It has not been tested on infants, and is not recommended for children under six years of age. Topical ivermectin preparations are effective for scabies in adults. It has also been useful for sarcoptic mange, the veterinary analog of human scabies. One review found that the efficacy of permethrin is similar to that of systemic or topical ivermectin. A separate review found that although oral ivermectin is usually effective for the treatment of scabies, it does have a higher treatment failure rate than topical permethrin. Another review found that oral ivermectin provided a reasonable balance between efficacy and safety. A study has demonstrated that scabies is markedly reduced in populations taking ivermectin regularly; the drug is widely used for treating scabies and other parasitic diseases, particularly among the poor and disadvantaged in the tropics, beginning with the developer Merck providing the drug at no cost to treat onchocerciasis from 1987.
== Depleted uranium == Depleted uranium used in kinetic energy penetrators is supposed to be made from uranium enrichment tailings that have never been irradiated in a nuclear reactor, not reprocessed uranium. It should then contain no detectable amount of uranium-236. However, there have been claims of it being found in some depleted uranium.
=== Other uses in science and technology === ADM formalism of general relativity Ammonium dimolybdate Arrow diagramming method, a network-diagramming technique Atomic demolition munition Auto Dynamic Metering, Olympus OM-2 camera light metering
Sources: en.wikipedia.org
== Reception == John Dickson Carr, a writer of locked-room mysteries, has his detective Dr. Gideon Fell declare this the "best detective tale ever written", in his novel The Hollow Man (1935). Agatha Christie praised The Mystery of the Yellow Room through the mouthpiece of her detective Hercule Poirot in her 1963 novel The Clocks:
=== Anti-thyroid drugs === Treatment with methimazole or propylthiouracil for hyperthyroidism, is commonly associated with an elevation of liver enzymes. To differentiate between hyperthyroidism and drug-related liver injury, it is recommended to check baseline liver enzymes prior to initiation of treatment. If liver injury related to anti-thyroid treatment is significant, switching to the alternative agent can be attempted in most cases. Cases of fulminant liver failure reported with propylthiouracil have led to a regulatory warning, and to guidelines recommending methimazole as the first line anti-thyroid agent.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
a DNA template that contains the DNA target region to amplify a DNA polymerase; an enzyme that polymerizes new DNA strands; heat-resistant Taq polymerase is especially common, as it is more likely to remain intact during the high-temperature DNA denaturation process. Pfu polymerase is a heat-resistant polymerase with higher accuracy compared to Taq due to its ability to proofread, but it runs slower. Adding a small amount of Pfu to Taq combines the benefits of both.
Sources: en.wikipedia.org
Cardarine targets PPARδ, a nuclear receptor involved in lipid and energy metabolism. It does not bind the androgen receptor in the way SARMs do.
Most methods use liquid chromatography with tandem mass spectrometry. Urine is common in anti-doping testing, and blood or plasma may be used in research.
Typical guidance is cool, dry, dark storage, often at low temperature and with desiccant. Stability data are limited, so storage conditions should be verified for each batch or supplier.
Rodent studies reported increased endurance and fat oxidation after GW501516 exposure. Long-term studies also found higher rates of some tumors, which led to halted development.